Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72252 Target Info
Target Name Caspase-7 (CASP7)
Synonyms MCH3; ICE-like apoptotic protease 3; ICE-LAP3; CMH-1; CASP-7; Apoptotic protease Mch-3
Target Type Clinical trial Target
Gene Name CASP7
Biochemical Class Peptidase
UniProt ID
P55210
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism Luciferase assays showed that miR-106b significantly reduces luciferase levels with the wild-type CASP7 3'UTR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism Caspase-7 is a direct target gene of miR-106a. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a can directly bind to the CASP7 via its respective 3'UTR. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism miR-224 negatively regulates CASP7 expressions by directly interacting with its 3'UTR. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-106b-25 cluster expression is associated with early disease recurrence and targets caspase-7 and focal adhesion in human prostate cancer. Oncogene. 2013 Aug 29;32(35):4139-47.
REF 2 Transcripts targeted by the microRNA-16 family cooperatively regulate cell cycle progression. Mol Cell Biol. 2007 Mar;27(6):2240-52.
REF 3 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.
REF 4 MicroRNA-146a down-regulation correlates with neuroprotection and targets pro-apoptotic genes in cerebral ischemic injury in vitro. Brain Res. 2016 Oct 1;1648(Pt A):136-143.
REF 5 MicroRNA-224 is implicated in lung cancer pathogenesis through targeting caspase-3 and caspase-7. Oncotarget. 2015 Sep 8;6(26):21802-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.