Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71190 Target Info
Target Name Stathmin-1 (STMN1)
Synonyms pp19; pp17; Stathmin; Protein Pr22; Prosolin; Phosphoprotein p19; Oncoprotein 18; OP18; Metablastin; Leukemia-associated phosphoprotein p18; LAP18; C1orf215
Target Type Literature-reported Target
Gene Name STMN1
UniProt ID
P16949
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism STMN1 is a target gene of miR-210 and inhibition of miR-210 expression augments cell proliferation by activating STMN1. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 directly suppressed STMN1 expression via sequence-specific interactions with 3'UTR of STMN1. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a targets STMN1 mRNA by binding to its 3'-untranslated region. [8]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunofluorescence; Luciferase Reporter Assay [8]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-193b-5p miRNA Info
miRNA Mature AC
MIMAT0004767
Sequence cgggguuuugagggcgagauga
miRNA Species Homo sapiens
Regulation Mechanism Stathmin 1 (STMN1) is the direct functional target of miR-193b in CRC. [9]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [9]
Representative Target(s) Regulated by This miRNA Stathmin-1 (STMN1) Target Info
STMN1_HUMAN
References  Top
REF 1 Stathmin1 plays oncogenic role and is a target of microRNA-223 in gastric cancer. PLoS One. 2012;7(3):e33919.
REF 2 Gain-of-function mutant p53 downregulates miR-223 contributing to chemoresistance of cultured tumor cells. Oncogene. 2014 Mar 20;33(12):1601-8.
REF 3 MicroRNA-223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1. Gastroenterology. 2008 Jul;135(1):257-69.
REF 4 miR-221 facilitates the TGFbeta1-induced epithelial-mesenchymal transition in human bladder cancer cells by targeting STMN1. BMC Urol. 2015 Apr 28;15:36.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 Epigenetic silencing of miR-210 increases the proliferation of gastric epithelium during chronic Helicobacter pylori infection. Nat Commun. 2014 Sep 4;5:4497.
REF 7 P18/Stathmin1 is regulated by miR-31 in ovarian cancer in response to taxane. Oncoscience. 2015 Mar 23;2(3):294-308.
REF 8 The Microtubule Network and Cell Death Are Regulated by an miR-34a/Stathmin 1/III-Tubulin Axis. Mol Cancer Res. 2017 Jul;15(7):953-964.
REF 9 miR-193b directly targets STMN1 and inhibits the malignant phenotype in colorectal cancer. Am J Cancer Res. 2016 Nov 1;6(11):2463-2475.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.