Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71023 Target Info
Target Name Synaptosomal-associated protein 25 (SNAP25)
Synonyms Synaptosomal-associated 25 kDa protein; Super protein; SUP; SNAP-25; SNAP
Target Type Successful Target
Gene Name SNAP25
Biochemical Class Synaptosomal vesicle fusion pore
UniProt ID
P60880
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-27a-5p miRNA Info
miRNA Mature AC
MIMAT0004501
Sequence agggcuuagcugcuugugagca
miRNA Species Homo sapiens
Regulation Mechanism miR-27a directly suppressed SNAP25 expressions through post-transcriptional gene silencing. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Gremlin-1 (Gremlin-1) Target Info
GREM1_HUMAN
miRNA Mature ID hsa-miR-641 miRNA Info
miRNA Mature AC
MIMAT0003311
Sequence aaagacauaggauagagucaccuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Synaptosomal-associated protein 25 (SNAP25) Target Info
SNP25_HUMAN
References  Top
REF 1 MicroRNA miR-27 Inhibits Adenovirus Infection by Suppressing the Expression of SNAP25 and TXN2. J Virol. 2017 May 26;91(12). pii: e00159-17.
REF 2 Association of impulsivity and polymorphic microRNA-641 target sites in the SNAP-25 gene. PLoS One. 2013 Dec 31;8(12):e84207.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.