Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T66505 Target Info
Target Name Smoothened homolog (SMO)
Synonyms Smo-D473H; SMOH; Protein Gx
Target Type Successful Target
Gene Name SMO
Biochemical Class GPCR frizzled
UniProt ID
Q99835
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-326 miRNA Info
miRNA Mature AC
MIMAT0000756
Sequence ccucugggcccuuccuccag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-326 by mature miRNA mimics tranfection resulted in the decreased protein level of target SMO. [3]
Evidence Score (E-score) 4 +
1 Immunofluorescence; qRT-PCR; Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot; qRT-PCR [3]
4 Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Fascin (FSCN1) Target Info
FSCN1_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism Introduction of premiR- 338-3p caused a significant increase of miR-338- 3p value and decreased SMO protein levels in SW-620 cells. [7]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
3 Western Blot [7]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-324-5p miRNA Info
miRNA Mature AC
MIMAT0000761
Sequence cgcauccccuagggcauuggugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-324-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target SMO. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [2]
2 Luciferase Reporter Assay; Western Blot; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-125b-5p miRNA Info
miRNA Mature AC
MIMAT0000423
Sequence ucccugagacccuaacuuguga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-125b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target SMO. [3]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-20a-3p miRNA Info
miRNA Mature AC
MIMAT0004493
Sequence acugcauuaugagcacuuaaag
miRNA Species Homo sapiens
Regulation Mechanism miR-20a directly targets SMO. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
Smoothened homolog (SMO) Target Info
SMO_HUMAN
References  Top
REF 1 Targeting the SMO oncogene by miR-326 inhibits glioma biological behaviors and stemness. Neuro Oncol. 2015 Feb;17(2):243-53.
REF 2 MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 2010 Apr;11(4):252-63.
REF 3 Concerted microRNA control of Hedgehog signalling in cerebellar neuronal progenitor and tumour cells. EMBO J. 2008 Oct 8;27(19):2616-27.
REF 4 Targeting of the signal transducer Smo links microRNA-326 to the oncogenic Hedgehog pathway in CD34+ CML stem/progenitor cells. Int J Cancer. 2013 Aug 1;133(3):579-89.
REF 5 MicroRNA-338-3p inhibits colorectal carcinoma cell invasion and migration by targeting smoothened. Jpn J Clin Oncol. 2014 Jan;44(1):13-21.
REF 6 miR-338-3p suppresses invasion of liver cancer cell by targeting smoothened. J Pathol. 2011 Nov;225(3):463-72.
REF 7 miRNA-338-3p suppresses cell growth of human colorectal carcinoma by targeting smoothened. World J Gastroenterol. 2013;19(14):2197-207.
REF 8 miR-20a regulates proliferation, differentiation and apoptosis in P19 cell model of cardiac differentiation by targeting Smoothened. Biol Open. 2016 Sep 15;5(9):1260-5.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.