Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65879 Target Info
Target Name Inhibitor of nuclear factor kappa-B kinase alpha (IKKA)
Synonyms Transcription factor 16; TCF16; TCF-16; Nuclear factor NFkappaB inhibitor kinase alpha; Nuclear factor NF-kappa-B inhibitor kinase alpha; NFKBIKA; Inhibitory kappa B kinasea; Inhibitor of nuclear factor kappa-B kinase subunit alpha; IkappaB kinase A; IkBKA; IKK1; IKK-alpha; IKK-A; I-kappa-B kinase alpha; I-kappa-B kinase 1; I kappa-B kinase alpha; Conserved helix-loop-helix ubiquitous kinase
Target Type Literature-reported Target
Gene Name CHUK
Biochemical Class Kinase
UniProt ID
O15111
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Literature Reported [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-195 suppresses multiple NF-kappaB downstream effectors by targeting IKKalpha. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism miR-23b suppresses nuclear factor k-B kinase subunit a (IKK-a) and, consequently, represses autoimmune inflammation. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with pre-miR-98 reduced protein and mRNA levels of CHUK. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
References  Top
REF 1 MiR-30e-5p and MiR-15a-5p Expressions in Plasma and Urine of Type 1 Diabetic Patients With Diabetic Kidney Disease. Front Genet. 2019 Jun 12;10:563.
REF 2 MicroRNAs modulate the noncanonical transcription factor NF-kappaB pathway by regulating expression of the kinase IKKalpha during macrophage differentiation. Nat Immunol. 2010 Sep;11(9):799-805.
REF 3 Genome-wide screening reveals that miR-195 targets the TNF-/NF-B pathway by down-regulating IB kinase alpha and TAB3 in hepatocellular carcinoma. Hepatology. 2013 Aug;58(2):654-66.
REF 4 miR-23a promotes IKK expression but suppresses ST7L expression to contribute to the malignancy of epithelial ovarian cancer cells. Br J Cancer. 2016 Sep 6;115(6):731-40.
REF 5 The microRNA miR-23b suppresses IL-17-associated autoimmune inflammation by targeting TAB2, TAB3 and IKK-. Nat Med. 2012 Jul;18(7):1077-86.
REF 6 MicroRNA mediation of endothelial inflammatory response to smooth muscle cells and its inhibition by atheroprotective shear stress. Circ Res. 2015 Mar 27;116(7):1157-69.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.