Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63024 Target Info
Target Name NF-kappa-B-activating kinase (TBK1)
Synonyms TANK-binding kinase 1; T2K; Serine/threonine-protein kinase TBK1; NAK
Target Type Patented-recorded Target
Gene Name TBK1
Biochemical Class Kinase
UniProt ID
Q9UHD2
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200c directly targets TBK1. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot; qPCR; Immunohistochemistry [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism miR-203 acts as a tumor suppressor via regulation of TBK1 expression. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-221-3p by mature miRNA precursor transfection resulted in the decreased protein level of target TBK1. [4]
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot; Microarray; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
References  Top
REF 1 miR-200c enhances radiosensitivity of human breast cancer cells. J Cell Biochem. 2013 Mar;114(3):606-15.
REF 2 MicroRNA-200c increases radiosensitivity of human cancer cells with activated EGFR-associated signaling. Oncotarget. 2017 Jul 3;8(39):65457-65468.
REF 3 MiR-203 Determines Poor Outcome and Suppresses Tumor Growth by Targeting TBK1 in Osteosarcoma. Cell Physiol Biochem. 2015;37(5):1956-66.
REF 4 miR-221 overexpression contributes to liver tumorigenesis. Proc Natl Acad Sci U S A. 2010 Jan 5;107(1):264-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.