Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T62705 Target Info
Target Name Inducible T-cell costimulator (ICOS)
Synonyms Inducible costimulator; Inducible T-cell co-stimulator; Inducible COSTIMULATOR precursor; CD278; Activation-inducible lymphocyte immunomediatory molecule; AILIM
Target Type Clinical trial Target
Gene Name ICOS
Biochemical Class Immunoglobulin
UniProt ID
Q9Y6W8
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-101-3p miRNA Info
miRNA Mature AC
MIMAT0000099
Sequence uacaguacugugauaacugaa
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-101-3p by mature miRNA precursor transfection resulted in the changed mRNA level of target ICOS. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
miRNA Mature ID hsa-miR-103a-3p miRNA Info
miRNA Mature AC
MIMAT0000101
Sequence agcagcauuguacagggcuauga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-103a-3p by mature miRNA precursor transfection resulted in the changed mRNA level of target ICOS. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
References  Top
REF 1 Roquin represses autoimmunity by limiting inducible T-cell co-stimulator messenger RNA. Nature. 2007 Nov 8;450(7167):299-303.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.