Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T60671 |
Target Info
|
| Target Name |
Chloride channel protein 3 (CLC-3) |
| Synonyms |
H(+)/Cl(-) exchange transporter 3; ClC-3 |
| Target Type |
Literature-reported Target |
| Gene Name |
CLCN3 |
| Biochemical Class |
Chloride channel |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-15a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcagcacauaaugguuugug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay; Northern Blot; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
