Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T59550 |
Target Info
|
| Target Name |
CI Man-6-P receptor (IGF2R) |
| Synonyms |
MPRI; MPR 300; M6PR; M6P/IGF2R; M6P/IGF2 receptor; Insulinlike growth factor II receptor; Insulinlike growth factor 2 receptor; Insulin-like growth factor II receptor; Insulin-like growth factor 2 receptor; IGFII receptor; IGF-II receptor; Cationindependent mannose6phosphate receptor; Cation-independent mannose-6-phosphate receptor; CIMPR; CI-MPR; CD222; 300 kDa mannose 6phosphate receptor; 300 kDa mannose 6-phosphate receptor |
| Target Type |
Clinical trial Target |
| Gene Name |
IGF2R |
| Biochemical Class |
Mannose 6-phosphate receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuucgccu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-657 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ggcagguucucacccucucuagg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The overexpression of miR-657 by mature miRNA precursor transfection resulted in the decreased protein level of target IGF2R. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
ELISA; qRT-PCR; Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
CI Man-6-P receptor (IGF2R)
|
Target Info
|
|
|
Melanoma differentiation-associated protein 6 (CDKN1A)
|
Target Info
|
|
| References |
Top |
| REF 1 |
New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.
|
| REF 2 |
Intronic miR-211 assumes the tumor suppressive function of its host gene in melanoma. Mol Cell. 2010 Dec 10;40(5):841-9.
|
| REF 3 |
Allele-specific targeting of hsa-miR-657 to human IGF2R creates a potential mechanism underlying the association of ACAA-insertion/deletion polymorphism with type 2 diabetes. Biochem Biophys Res Commun. 2008 Sep 12;374(1):101-5.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
