Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T59459 |
Target Info
|
| Target Name |
JNK-interacting protein 1 peptide (pepJIP1) |
| Synonyms |
PRKM8IP; Mitogen-activated protein kinase 8-interacting protein 1; JNK-interacting protein 1; JNK MAP kinase scaffold protein 1; JIP1; JIP-1; Islet-brain 1; IB1; IB-1; C-Jun-amino-terminal kinase-interacting protein 1 |
| Target Type |
Patented-recorded Target |
| Gene Name |
MAPK8IP1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-10a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uacccuguagauccgaauuugug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-10a-5p directly targets MAPK8IP1, as a mojr mechanism for gastric cancer metastasis. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Direct targeting of MAPK8IP1 by miR-10a-5p is a major mechanism for gastric cancer metastasis. Oncol Lett. 2017 Mar;13(3):1131-1136.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
