Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T59190 Target Info
Target Name Protein kinase C zeta (PRKCZ)
Synonyms Protein kinase C zeta type; PKC2; NPKC-zeta
Target Type Patented-recorded Target
Gene Name PRKCZ
Biochemical Class Kinase
UniProt ID
Q05513
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-25-5p miRNA Info
miRNA Mature AC
MIMAT0004498
Sequence aggcggagacuugggcaauug
miRNA Species Homo sapiens
Regulation Mechanism miR-25-5p targets PKCZ 3'UTR. [2]
Evidence Score (E-score) 2 +
1 qPCR; Immunoblot [1]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
Protein kinase C zeta (PRKCZ) Target Info
KPCZ_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-200c significantly decreased the luciferase activity driven by PKCZ-3'UTR, whereas a reporter mutated in PKCZ-3'UTR failed to respond to miR-200c expression. [3]
Evidence Score (E-score) 1 +
1 Immunoblot; Immunohistochemistry; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 The Secretion of miR-200s by a PKC/ADAR2 Signaling Axis Promotes Liver Metastasis in Colorectal Cancer. Cell Rep. 2018 Apr 24;23(4):1178-1191.
REF 2 microRNA-25 targets PKC and protects osteoblastic cells from dexamethasone via activating AMPK signaling. Oncotarget. 2017 Jan 10;8(2):3226-3236.
REF 3 Retinoic acid directs breast cancer cell state changes through regulation of TET2-PKC pathway. Oncogene. 2017 Jun 1;36(22):3193-3206.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.