Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T58470 | Target Info | |||
| Target Name | Cyclin A2 (CCNA2) | ||||
| Synonyms | Cyclin-A2; Cyclin-A; Cyclin A; CCNA | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | CCNA2 | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7b-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagguaguagguugugugguu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Immunoblot; Immunofluorescence; Luciferase Reporter Assay | [1] | |||
| 2 | RT-PCR | [2] | |||
| Representative Target(s) Regulated by This miRNA | Activin receptor-like kinase 2 (ALK-2) | Target Info | |||
| CDK inhibitor 1B p27Kip1 (CDKN1B) | Target Info | ||||
| miRNA Mature ID | hsa-miR-130b-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cagugcaaugaugaaagggcau | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| 2 | PAR-CLIP | [4] | |||
| Representative Target(s) Regulated by This miRNA | Acyl-CoA desaturase (SCD) | Target Info | |||
| Cyclin A2 (CCNA2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-146a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagaacugaauuccauggguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | CCNA2 was potentially regulated by miR-146a. | [5] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Western Blot | [5] | |||
| 2 | Western Blot | [6] | |||
| Representative Target(s) Regulated by This miRNA | Activation B7-1 antigen (CD80) | Target Info | |||
| Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
| miRNA Mature ID | hsa-miR-22-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aagcugccaguugaagaacugu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | CCNA2 mRNA levels were reduced by inhibition of miR-22. | [7] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [7] | |||
| 2 | Western Blot | [8] | |||
| Representative Target(s) Regulated by This miRNA | 5-HT 2C receptor (HTR2C) | Target Info | |||
| ATP-citrate synthase (ACLY) | Target Info | ||||
| miRNA Mature ID | hsa-miR-24-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uggcucaguucagcaggaacag | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | qRT-PCR | [9] | |||
| Representative Target(s) Regulated by This miRNA | Activin receptor type IB (ACVR1B) | Target Info | |||
| Aurora kinase B (AURKB) | Target Info | ||||
| miRNA Mature ID | hsa-miR-132-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaacagucuacagccauggucg | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Western Blot; qRT-PCR | [10] | |||
| Representative Target(s) Regulated by This miRNA | Brain-derived neurotrophic factor (BDNF) | Target Info | |||
| Cyclin A2 (CCNA2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-212-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uaacagucuccagucacggcc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Western Blot; qRT-PCR | [10] | |||
| Representative Target(s) Regulated by This miRNA | Acetylcholinesterase (AChE) | Target Info | |||
| Adenylate cyclase type 1 (ADCY1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-27b-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucacaguggcuaaguucugc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | cyclin A2 may be a novel target of miR-27b. | [11] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [11] | |||
| Representative Target(s) Regulated by This miRNA | Adenosine A2b receptor (ADORA2B) | Target Info | |||
| Albendazole monooxygenase (CYP3A4) | Target Info | ||||
| miRNA Mature ID | hsa-miR-10b-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | acagauucgauucuaggggaau | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | The transfection with an inhibitor of miR-10b activity in untransformed MCF10A cells leads to an increase of CCNA2. | [12] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [12] | |||
| Representative Target(s) Regulated by This miRNA | BUB1 mitotic checkpoint serine/threonine kinase (BUB1) | Target Info | |||
| Cyclin A2 (CCNA2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 2 | Expression of hsa-let-7b-5p, hsa-let-7f-5p, and hsa-miR-222-3p and their putative targets HMGA2 and CDKN1B in typical and atypical carcinoid tumors... Tumour Biol. 2017 Oct;39(10):1010428317728417. | ||||
| REF 3 | Mir-23b and miR-130b expression is downregulated in pituitary adenomas. Mol Cell Endocrinol. 2014 Jun 5;390(1-2):1-7. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | Identification of the potential target genes of microRNA-146a induced by PMA treatment in human microvascular endothelial cells. Exp Cell Res. 2010 Apr 15;316(7):1119-26. | ||||
| REF 6 | Delayed Cell Cycle Progression in STHdh(Q111)/Hdh(Q111) Cells, a Cell Model for Huntington's Disease Mediated by microRNA-19a, microRNA-146a and mi... Microrna. 2015;4(2):86-100. | ||||
| REF 7 | MiR-22-silenced cyclin A expression in colon and liver cancer cells is regulated by bile acid receptor. J Biol Chem. 2015 Mar 6;290(10):6507-15. | ||||
| REF 8 | Waltonitone inhibits proliferation of hepatoma cells and tumorigenesis via FXR-miR-22-CCNA2 signaling pathway. Oncotarget. 2016 Nov 15;7(46):75165-75175. | ||||
| REF 9 | miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25. | ||||
| REF 10 | miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23. | ||||
| REF 11 | Ionizing radiation-inducible miR-27b suppresses leukemia proliferation via targeting cyclin A2. Int J Radiat Oncol Biol Phys. 2014 Sep 1;90(1):53-62. | ||||
| REF 12 | miR-10b*, a master inhibitor of the cell cycle, is down-regulated in human breast tumours. EMBO Mol Med. 2012 Nov;4(11):1214-29. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.