Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T54229 |
Target Info
|
Target Name |
Angiogenin (ANG) |
Synonyms |
Ribonuclease 5; RNase 5; RNASE5 |
Target Type |
Literature-reported Target |
Gene Name |
ANG |
Biochemical Class |
Endoribonucleases |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-93-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuguucgugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-409-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gaauguugcucggugaaccccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Angiogenin (ANG)
|
Target Info
|
|
Fibrinogen (FGG)
|
Target Info
|
|
References |
Top |
REF 1 |
The role of microRNA-93 regulating angiopoietin2 in the formation of malignant pleural effusion. Cancer Med. 2017 May;6(5):1036-1048.
|
REF 2 |
miR-409-3p inhibits HT1080 cell proliferation, vascularization and metastasis by targeting angiogenin. Cancer Lett. 2012 Oct 28;323(2):171-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.