Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T53585 Target Info
Target Name HMG-CoA reductase (HMGCR)
Synonyms 3-hydroxy-3-methylglutaryl-coenzyme A reductase
Target Type Successful Target
Gene Name HMGCR
Biochemical Class CH-OH donor oxidoreductase
UniProt ID
P04035
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29 inhibition alleviates miR-29-mediated direct repression of HMGCR, thereby counteracting the overall suppressive effect of miR-29 inhibition on the cholesterol synthesis pathway. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29s decreased HMGCR 3'UTR luciferase activity. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Sequencing [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-27 markedly reduced luciferase activity and that a mutation in the target site of miR-27 within the HMGCR 3'UTR significantly rescued luciferase activity. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 Dicer1/miR-29/HMGCR axis contributes to hepatic free cholesterol accumulation in mouse non-alcoholic steatohepatitis. Acta Pharmacol Sin. 2017 May;38(5):660-671.
REF 2 Inhibition of miR-29 has a significant lipid-lowering benefit through suppression of lipogenic programs in liver. Sci Rep. 2015 Aug 6;5:12911.
REF 3 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 4 Transcriptomic Analysis of Chronic Hepatitis B and C and Liver Cancer Reveals MicroRNA-Mediated Control of Cholesterol Synthesis Programs. MBio. 2015 Dec 8;6(6):e01500-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.