Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T53159 | Target Info | |||
| Target Name | ERK activator kinase 7 (MAP2K7) | ||||
| Synonyms | Stress-activated protein kinase kinase 4; SKK4; SAPKK4; SAPKK-4; SAPK kinase 4; PRKMK7; Mitogen-activated protein kinase kinase 7; MKK7; MEK7; MEK 7; MAPKK 7; MAPK/ERK kinase7; MAPK/ERK kinase 7; MAP kinase kinase 7; JNKK2; JNKK 2; JNK-activating kinase 2; JNK kinase 2; JNK activating kinase 2; Dual specificity mitogen-activated protein kinase kinase 7; C-Jun N-terminal kinase kinase 2 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | MAP2K7 | ||||
| Biochemical Class | Kinase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-125b-1-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | acggguuaggcucuugggagcu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-125b targets MAP2K7 and inhibits EMT. | [1] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [1] | |||
| Representative Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Target Info | |||
| ERK activator kinase 7 (MAP2K7) | Target Info | ||||
| miRNA Mature ID | hsa-miR-493-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugaaggucuacugugugccagg | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | MKK7 is a major functional target of miR-493, and its suppression thwarts liver metastasis of colon cancer cells. | [2] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Dickkopf-related protein 1 (DKK1) | Target Info | |||
| ERK activator kinase 7 (MAP2K7) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | miR-125b inhibited epithelial-mesenchymal transition of triple-negative breast cancer by targeting MAP2K7. Onco Targets Ther. 2016 May 4;9:2639-48. | ||||
| REF 2 | MKK7 mediates miR-493-dependent suppression of liver metastasis of colon cancer cells. Cancer Sci. 2014 Apr;105(4):425-30. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.