miRNA General Information
miRNA Mature ID hsa-miR-493-3p
miRNA Stemloop AC MI0003132
miRNA Stemloop ID hsa-mir-493
Sequence ugaaggucuacugugugccagg
TTD Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Clinical trial Target Target Info [1]
ERK activator kinase 7 (MAP2K7) Literature-reported Target Target Info [2]
Protein(s) Regulated by This miRNA Frizzled-4 Regulated Protein [3]
Max-interacting protein 1 Regulated Protein [4]
Rho-related GTP-binding protein RhoC Regulated Protein [3]
References
REF 1 miR-493 mediated DKK1 down-regulation confers proliferation, invasion and chemo-resistance in gastric cancer cells. Oncotarget. 2016 Feb 9;7(6):7044-54.
REF 2 MKK7 mediates miR-493-dependent suppression of liver metastasis of colon cancer cells. Cancer Sci. 2014 Apr;105(4):425-30.
REF 3 Tumor suppressor microRNA-493 decreases cell motility and migration ability in human bladder cancer cells by downregulating RhoC and FZD4.Mol Cancer Ther. 2012 Jan;11(1):244-53.
REF 4 Novel Mad2-targeting miR-493-3p controls mitotic fidelity and cancer cells' sensitivity to paclitaxel.Oncotarget. 2016 Mar 15;7(11):12267-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.