miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-493-3p | ||||
miRNA Stemloop AC | MI0003132 | ||||
miRNA Stemloop ID | hsa-mir-493 | ||||
Sequence | ugaaggucuacugugugccagg | ||||
TTD Target(s) Regulated by This miRNA | Dickkopf-related protein 1 (DKK1) | Clinical trial Target | Target Info | [1] | |
ERK activator kinase 7 (MAP2K7) | Literature-reported Target | Target Info | [2] | ||
Protein(s) Regulated by This miRNA | Frizzled-4 | Regulated Protein | [3] | ||
Max-interacting protein 1 | Regulated Protein | [4] | |||
Rho-related GTP-binding protein RhoC | Regulated Protein | [3] | |||
References | |||||
REF 1 | miR-493 mediated DKK1 down-regulation confers proliferation, invasion and chemo-resistance in gastric cancer cells. Oncotarget. 2016 Feb 9;7(6):7044-54. | ||||
REF 2 | MKK7 mediates miR-493-dependent suppression of liver metastasis of colon cancer cells. Cancer Sci. 2014 Apr;105(4):425-30. | ||||
REF 3 | Tumor suppressor microRNA-493 decreases cell motility and migration ability in human bladder cancer cells by downregulating RhoC and FZD4.Mol Cancer Ther. 2012 Jan;11(1):244-53. | ||||
REF 4 | Novel Mad2-targeting miR-493-3p controls mitotic fidelity and cancer cells' sensitivity to paclitaxel.Oncotarget. 2016 Mar 15;7(11):12267-85. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.