Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T50914 Target Info
Target Name Protein phosphatase 1D (PPM1D)
Synonyms p53-induced protein phosphatase 1; WIP1; Protein phosphatase magnesium-dependent 1 delta; Protein phosphatase 2C isoform delta; PP2C-delta
Target Type Literature-reported Target
Gene Name PPM1D
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
O15297
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Literature Reported [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-15b led to a reduction in PPM1D mRNA, whereas miR-15b knockdown resulted in an increase in PPM1D Mrna. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29a directly interacted with the 3'UTR of PPM1D,attesting that they are direct target genes of miR-29a. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 Downregulation of miR-145-5p in cancer cells and their derived exosomes may contribute to the development of ovarian cancer by targeting CT. Int J Mol Med. 2019 Jan;43(1):256-266.
REF 2 Oncogenic Wip1 phosphatase is inhibited by miR-16 in the DNA damage signaling pathway. Cancer Res. 2010 Sep 15;70(18):7176-86.
REF 3 miR-15b/16-2 regulates factors that promote p53 phosphorylation and augments the DNA damage response following radiation in the lung. J Biol Chem. 2014 Sep 19;289(38):26406-16.
REF 4 microRNA expression alteration after arsenic trioxide treatment in HepG-2 cells. J Gastroenterol Hepatol. 2011 Jan;26(1):186-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.