Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49522 Target Info
Target Name Pleiotrophin (PTN)
Synonyms Osteoblast-specific factor 1; Osteoblast specific factor 1; OSF-1; NEGF1; Heparin-binding neurite outgrowth-promoting factor 1; Heparin-binding neurite outgrowth-promoting factor; Heparin-binding neurite outgrowth promoting factor 1; Heparin-binding growth-associated molecule; Heparin-binding brain mitogen; HBNF1; HBNF-1; HBNF; HBBM; HB-GAM
Target Type Literature-reported Target
Gene Name PTN
UniProt ID
P21246
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
References  Top
REF 1 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.