Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T48040 Target Info
Target Name DNA repair protein complementing XP-A cells (XPA)
Synonyms Xeroderma pigmentosum group A-complementing protein; XPAC; XPA protein
Target Type Literature-reported Target
Gene Name XPA
UniProt ID
P23025
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [1]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
References  Top
REF 1 MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 2009 Feb 1;69(3):1221-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.