Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T46000 |
Target Info
|
| Target Name |
MEK kinase kinase 3 (MAP4K3) |
| Synonyms |
RAB8IPL1; Mitogen-activated protein kinase kinase kinase kinase 3; MEKKK 3; MAPK/ERK kinase kinase kinase 3; Germinal center kinase-related protein kinase; GLK |
| Target Type |
Literature-reported Target |
| Gene Name |
MAP4K3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-let-7c-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagguaguagguuguaugguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The 3'UTR of MAP4K3 contains let-7c binding sites. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-199a-5p and let-7c cooperatively inhibit migration and invasion by targeting MAP4K3 in hepatocellular carcinoma. Oncotarget. 2017 Feb 21;8(8):13666-13677.
|
| REF 2 |
MicroRNA let-7c inhibits migration and invasion of human non-small cell lung cancer by targeting ITGB3 and MAP4K3. Cancer Lett. 2014 Jan 1;342(1):43-51.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
