Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T45612 Target Info
Target Name B7 homolog 3 (CD276)
Synonyms UNQ309/PRO352; PSEC0249; Costimulatory molecule; CD276 antigen; B7H3; B7-H3; 4IgB7H3; 4Ig-B7-H3
Target Type Clinical trial Target
Gene Name CD276
Biochemical Class Immunoglobulin
UniProt ID
Q5ZPR3
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-187-3p miRNA Info
miRNA Mature AC
MIMAT0000262
Sequence ucgugucuuguguugcagccgg
miRNA Species Homo sapiens
Regulation Mechanism B7 homolog 3 (B7-H3,CD276) is a direct target of miR-187. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA B7 homolog 3 (CD276) Target Info
CD276_HUMAN
S100 calcium-binding protein A4 (S100A4) Target Info
S10A4_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29a-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target CD276. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
References  Top
REF 1 MicroRNA-187, down-regulated in clear cell renal cell carcinoma and associated with lower survival, inhibits cell growth and migration though targeting B7-H3. Biochem Biophys Res Commun. 2013 Aug 23;438(2):439-44.
REF 2 MicroRNA-187 inhibits tumor growth and invasion by directly targeting CD276 in colorectal cancer. Oncotarget. 2016 Jul 12;7(28):44266-44276.
REF 3 MicroRNA miR-29 modulates expression of immunoinhibitory molecule B7-H3: potential implications for immune based therapy of human solid tumors. Cancer Res. 2009 Aug 1;69(15):6275-81.
REF 4 Fibrotic extracellular matrix activates a profibrotic positive feedback loop. J Clin Invest. 2014 Apr;124(4):1622-35.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.