Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T45593 |
Target Info
|
| Target Name |
Microtubule-associated protein tau (MAPT) |
| Synonyms |
tau; Paired helical filamenttau; Paired helical filament-tau; Neurofibrillary tangle protein; MTBT1; MAPTL |
| Target Type |
Clinical trial Target |
| Gene Name |
MAPT |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34c-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aggcaguguaguuagcugauugc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase activity assay confirmed that the 3'UTR of MAPT mRNA contains a functional miR-34c-5p binding site. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Cyclin-dependent kinase 4 (CDK4)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Regulation of microtubule-associated protein tau (MAPT) by miR-34c-5p determines the chemosensitivity of gastric cancer to paclitaxel. Cancer Chemother Pharmacol. 2013 May;71(5):1159-71.
|
| REF 2 |
Developmental exposure to lead (Pb) alters the expression of the human tau gene and its products in a transgenic animal model. Neurotoxicology. 2016 Jul;55:154-159.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
