Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T45357 Target Info
Target Name B-cell translocation gene 1 protein (BTG1)
Synonyms Protein BTG1
Target Type Literature-reported Target
Gene Name BTG1
UniProt ID
P62324
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism BTG1 is the direct target gene of miR-22. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism BTG1 is directly targeted by miR-372. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism BTG1 is directly targeted by miR-373. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-19a-5p miRNA Info
miRNA Mature AC
MIMAT0004490
Sequence aguuuugcauaguugcacuaca
miRNA Species Homo sapiens
Regulation Mechanism miR-19a regulates proliferation and apoptosis of CRPC cells by directly targeting the tumor suppressor gene BTG1. [3]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Zinc finger protein A20 (TNFAIP3) Target Info
TNAP3_HUMAN
miRNA Mature ID hsa-miR-301a-5p miRNA Info
miRNA Mature AC
MIMAT0022696
Sequence gcucugacuuuauugcacuacu
miRNA Species Homo sapiens
Regulation Mechanism BTG1 mRNA is a target of miR-301a. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
References  Top
REF 1 MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett. 2015 Jan 28;356(2 Pt B):781-90.
REF 2 -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78.
REF 3 MicroRNA-19a regulates proliferation and apoptosis of castration-resistant prostate cancer cells by targeting BTG1. FEBS Lett. 2015 Jun 4;589(13):1485-90.
REF 4 MicroRNA 301A Promotes Intestinal Inflammation and Colitis-Associated Cancer Development by Inhibiting BTG1. Gastroenterology. 2017 May;152(6):1434-1448.e15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.