Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T44684 Target Info
Target Name Notch-3 receptor (NOTCH3)
Synonyms Notch 3 intracellular domain; Notch 3; Neurogenic locus notch homolog protein 3
Target Type Clinical trial Target
Gene Name NOTCH3
Biochemical Class Notch protein
UniProt ID
Q9UM47
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism Modulation of microRNA expression in human T-cell development targeting of NOTCH3 by miR-150. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-206 resulted in a significant reduction of human Notch3 protein expression and the level of human notch3 mRNA was also repressed by miR-206. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 qRT-PCR; Immunohistochemistry; Western Blot [4]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-491-5p miRNA Info
miRNA Mature AC
MIMAT0002807
Sequence aguggggaacccuuccaugagg
miRNA Species Homo sapiens
Regulation Mechanism miR-491-5p suppressed NOTCH3 expression both at the mRNA and protein level through directly targeting the 3'UTR of NOTCH3 mRNA. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-483-5p miRNA Info
miRNA Mature AC
MIMAT0004761
Sequence aagacgggaggaaagaagggag
miRNA Species Homo sapiens
Regulation Mechanism miR-483-5p suppresses the expression of NOTCH3 by directly binding the 3'UTR of NOTCH3 mRNA. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Extracellular signal-regulated kinase 1 (ERK1) Target Info
MK03_HUMAN
miRNA Mature ID hsa-miR-136-3p miRNA Info
miRNA Mature AC
MIMAT0004606
Sequence caucaucgucucaaaugagucu
miRNA Species Homo sapiens
Regulation Mechanism NOTCH3 is a target of miR-136. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Notch-3 receptor (NOTCH3) Target Info
NOTC3_HUMAN
References  Top
REF 1 Modulation of microRNA expression in human T-cell development: targeting of NOTCH3 by miR-150. Blood. 2011 Jun 30;117(26):7053-62.
REF 2 miR-150 enhances apoptotic and anti-tumor effects of paclitaxel in paclitaxel-resistant ovarian cancer cells by targeting Notch3. Oncotarget. 2017 Aug 18;8(42):72788-72800.
REF 3 MicroRNA-206 targets notch3, activates apoptosis, and inhibits tumor cell migration and focus formation. J Biol Chem. 2009 Nov 13;284(46):31921-7.
REF 4 MicroRNA-206 attenuates tumor proliferation and migration involving the downregulation of NOTCH3 in colorectal cancer. Oncol Rep. 2015 Mar;33(3):1402-10.
REF 5 miR-491-5p suppresses cell growth and invasion by targeting Notch3 in nasopharyngeal carcinoma. Oncol Rep. 2016 Jun;35(6):3541-7.
REF 6 Characterization of microRNA profile in human cumulus granulosa cells: Identification of microRNAs that regulate Notch signaling and are associated with PCOS. Mol Cell Endocrinol. 2015 Mar 15;404:26-36.
REF 7 MicroRNA-136 inhibits cancer stem cell activity and enhances the anti-tumor effect of paclitaxel against chemoresistant ovarian cancer cells by targeting Notch3. Cancer Lett. 2017 Feb 1;386:168-178.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.