Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T43814 |
Target Info
|
Target Name |
Toll/interleukin-1 receptor domain-containing adapter (TIRAP) |
Synonyms |
Toll/interleukin-1 receptor domain-containing adapter protein; TIR domain-containing adapter protein; MyD88-2; MyD88 adapter-like protein; MAL; Adaptor protein Wyatt |
Target Type |
Patented-recorded Target |
Gene Name |
TIRAP |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
guccaguuuucccaggaaucccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Toll Unterleukin-1 receptor domain Uontaining adaptor protein (TIRAP) is a respective targets of miR-145. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunoprecipitation; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
References |
Top |
REF 1 |
Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.