Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T43814 Target Info
Target Name Toll/interleukin-1 receptor domain-containing adapter (TIRAP)
Synonyms Toll/interleukin-1 receptor domain-containing adapter protein; TIR domain-containing adapter protein; MyD88-2; MyD88 adapter-like protein; MAL; Adaptor protein Wyatt
Target Type Patented-recorded Target
Gene Name TIRAP
UniProt ID
P58753
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Toll Unterleukin-1 receptor domain Uontaining adaptor protein (TIRAP) is a respective targets of miR-145. [1]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Western Blot [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
References  Top
REF 1 Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.