Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T43206 Target Info
Target Name Nuclear receptor ROR-alpha (RORA)
Synonyms Retinoid-related orphan receptor-alpha; Retinoic acid-related orphan receptor alpha; RZRA; RAR-related orphan receptor A; Nuclear receptor subfamily 1 group F member 1; Nuclear receptor RZR-alpha; NR1F1
Target Type Preclinical Target
Gene Name RORA
Biochemical Class Nuclear hormone receptor
UniProt ID
P35398
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-33b binds to the 3'UTR of RORA. miR-33b significantly repressed RORA 3'UTR activities. Mutation of the miR-33 target sites relieved miR-33 repression of the RORA 3'UTR activities, consistent with a direct interaction of miR-33 with these sites. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
References  Top
REF 1 MicroRNA 33 regulates glucose metabolism. Mol Cell Biol. 2013 Aug;33(15):2891-902.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.