Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T42928 |
Target Info
|
| Target Name |
Fibroblast growth factor-21 (FGF21) |
| Synonyms |
UNQ3115/PRO10196; Fibroblast growth factor 21; FGF-21 |
| Target Type |
Clinical trial Target |
| Gene Name |
FGF21 |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-149-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucuggcuccgugucuucacuccc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-577 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagauaaaauauugguaccug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot; Immunoblot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Fibroblast growth factor-21 (FGF21)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-149 controls non-alcoholic fatty liver by targeting FGF-21. J Cell Mol Med. 2016 Aug;20(8):1603-8.
|
| REF 2 |
MiR-577 inhibits pancreatic -cell function and survival by targeting fibroblast growth factor 21 (FGF-21) in pediatric diabetes. Genet Mol Res. 2015 Dec 1;14(4):15462-70.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
