miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-577 | ||||
| miRNA Stemloop AC | MI0003584 | ||||
| miRNA Stemloop ID | hsa-mir-577 | ||||
| Sequence | uagauaaaauauugguaccug | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor-21 (FGF21) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Heat shock protein beta-2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | MiR-577 inhibits pancreatic -cell function and survival by targeting fibroblast growth factor 21 (FGF-21) in pediatric diabetes. Genet Mol Res. 2015 Dec 1;14(4):15462-70. | ||||
| REF 2 | microRNA-577 suppresses tumor growth and enhances chemosensitivity in colorectal cancer. J Biochem Mol Toxicol. 2017 Jun;31(6). | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.