Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T42446 Target Info
Target Name Gamma-aminobutyric acid B receptor (GABBR)
Synonyms Gamma-aminobutyric acid type B receptor; GPRC3; GABABR; GABA-BR; GABA-B-R; GABA-B receptor
Target Type Successful Target
Gene Name GABBR1; GABBR2
Biochemical Class GPCR glutamate
UniProt ID
Q9UBS5; O75899
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.