Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T41988 |
Target Info
|
| Target Name |
Homeobox protein Nkx-3.1 (NKX3-1) |
| Synonyms |
NKX3A; NKX31; NKX3.1; Homeobox protein Nkx3.1; Homeobox protein NK3 homolog A; Homeobox protein NK-3 homolog A |
| Target Type |
Literature-reported Target |
| Gene Name |
NKX3-1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Reporter assays showed decreased luciferase activity after miR-155- NKX3.1 interaction as well as intrinsic NKX3-1 protein levels were decreased after miR-155 transfection. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-378b |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acuggacuuggaggcagaa
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-378b repressed NKX3.1 through two binding sites in the 3'UTR region. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Homeobox protein Nkx-3.1 (NKX3-1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Structural analysis of microRNA-target interaction by sequential seed mutagenesis and stem-loop 3' RACE. PLoS One. 2013 Nov 25;8(11):e81427.
|
| REF 2 |
Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
|
| REF 3 |
MiR-378b Promotes Differentiation of Keratinocytes through NKX3.1. PLoS One. 2015 Aug 27;10(8):e0136049.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
