Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T39321 |
Target Info
|
Target Name |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) |
Synonyms |
Peptidyl-cysteine S-nitrosylase GAPDH; OK/SW-cl.12; GAPD; D-glyceraldehyde-3-phosphate dehydrogenase; CDABP0047 |
Target Type |
Clinical trial Target |
Gene Name |
GAPDH |
Biochemical Class |
Aldehyde/oxo donor oxidoreductase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-644a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aguguggcuuucuuagagc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
GAPDH is a direct target of miR-644a. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccauuugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Introduction of mir-29c down-regulated GAPDH at the level of mRNA and inhibited expression of luciferase encoded by vectors having the 3'UTR of SPARC. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
B7 homolog 3 (CD276)
|
Target Info
|
|
References |
Top |
REF 1 |
MiR-644a Disrupts Oncogenic Transformation and Warburg Effect by Direct Modulation of Multiple Genes of Tumor-Promoting Pathways. Cancer Res. 2019 Apr 15;79(8):1844-1856.
|
REF 2 |
Housekeeping gene selection advisory: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and -actin are targets of miR-644a. PLoS One. 2012;7(10):e47510.
|
REF 3 |
MicroRNA 29c is down-regulated in nasopharyngeal carcinomas, up-regulating mRNAs encoding extracellular matrix proteins. Proc Natl Acad Sci U S A. 2008 Apr 15;105(15):5874-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.