Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38529 Target Info
Target Name Prostaglandin E2 receptor EP2 (PTGER2)
Synonyms Prostanoid EP2 receptor; Prostaglandin E2 receptor EP2 subtype; PGE2 receptor EP2 subtype; PGE receptor, EP2 subtype; PGE receptor EP2 subtype; EP2 receptor
Target Type Successful Target
Gene Name PTGER2
Biochemical Class GPCR rhodopsin
UniProt ID
P43116
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-149-5p miRNA Info
miRNA Mature AC
MIMAT0000450
Sequence ucuggcuccgugucuucacuccc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
References  Top
REF 1 Epigenetic silencing of microRNA-149 in cancer-associated fibroblasts mediates prostaglandin E2/interleukin-6 signaling in the tumor microenvironment. Cell Res. 2015 May;25(5):588-603.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.