Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38428 Target Info
Target Name Forkhead box protein Q1 (FOXQ1)
Synonyms Hepatocyte nuclear factor 3 forkhead homolog 1; HNF3/forkheadlike protein 1; HNF-3/forkhead-like protein 1; HFH1; HFH-1
Target Type Literature-reported Target
Gene Name FOXQ1
UniProt ID
Q9C009
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism Over-expression of miR-506 remarkably repressed the luciferase activity of the reporter gene with the wild-type construct but not with the mutant FOXQ1 3' UTR construct, which indicates that miR-506 directly targeted the FOXQ1 3' UTR. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-1271-5p miRNA Info
miRNA Mature AC
MIMAT0005796
Sequence cuuggcaccuagcaagcacuca
miRNA Species Homo sapiens
Regulation Mechanism miR-1271 inhibits cell proliferation, invasion, and EMT in gastric cancer by directly suppressing FOXQ1 expression. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Western Blot [4]
Representative Target(s) Regulated by This miRNA Forkhead box protein Q1 (FOXQ1) Target Info
FOXQ1_HUMAN
Glypican-3 (GPC3) Target Info
GPC3_HUMAN
miRNA Mature ID hsa-miR-422a miRNA Info
miRNA Mature AC
MIMAT0001339
Sequence acuggacuuagggucagaaggc
miRNA Species Homo sapiens
Regulation Mechanism The luciferase activities of FOXG1 reporter were significantly repressed by miR-422a and the mutation of miR-422a-binding sites in the 3'UTR region totally abrogated miR-422a repression of luciferase activity. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot [5]
Representative Target(s) Regulated by This miRNA Ecto-5'-nucleotidase (CD73) Target Info
5NTD_HUMAN
Forkhead box protein Q1 (FOXQ1) Target Info
FOXQ1_HUMAN
References  Top
REF 1 Suppression of forkhead box Q1 by microRNA-506 represses the proliferation and epithelial-mesenchymal transition of cervical cancer cells. Oncol Rep. 2016 May;35(5):3106-14.
REF 2 MiR-506 suppresses tumor proliferation and invasion by targeting FOXQ1 in nasopharyngeal carcinoma. PLoS One. 2015 Apr 9;10(4):e0122851.
REF 3 MiR-1271 Inhibits Cell Proliferation, Invasion and EMT in Gastric Cancer by Targeting FOXQ1. Cell Physiol Biochem. 2015;36(4):1382-94.
REF 4 MicroRNA-1271 inhibits cellular proliferation of hepatocellular carcinoma. Oncol Lett. 2017 Dec;14(6):6783-6788.
REF 5 Double-negative feedback loop between microRNA-422a and forkhead box (FOX)G1/Q1/E1 regulates hepatocellular carcinoma tumor growth and metastasis. Hepatology. 2015 Feb;61(2):561-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.