Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T38301 |
Target Info
|
| Target Name |
Ribonucleoside-diphosphate reductase M2 (RRM2) |
| Synonyms |
Ribonucleotide reductase small subunit; Ribonucleotide reductase small chain; Ribonucleoside-diphosphate reductase subunit M2; RR2 |
| Target Type |
Successful Target |
| Gene Name |
RRM2 |
| Biochemical Class |
CH/CH(2) oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-211-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuucgccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Induction of miR-211 expression increased the sensitivity to gemcitabine and reduced the expression of its target RRM2. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qPCR |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Calcium-activated potassium channel KCa1.1 (KCNMA1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-211 regulates the expression of RRM2 in tumoral metastasis and recurrence in colorectal cancer patients with a k-ras gene mutation. Oncol Lett. 2018 May;15(5):8107-8117.
|
| REF 2 |
miR-211 modulates gemcitabine activity through downregulation of ribonucleotide reductase and inhibits the invasive behavior of pancreatic cancer cells. Nucleosides Nucleotides Nucleic Acids. 2014;33(4-6):384-93.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
