Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T37735 Target Info
Target Name Glutamate decarboxylase (GLUL)
Synonyms Glutamateammonia ligase
Target Type Discontinued Target
Gene Name GLUL
Biochemical Class Carbon-nitrogen ligase
UniProt ID
P15104
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism GLUL is one of the targets of miR-29a and that miR-29a can downregulate GLUL by translational repression. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
References  Top
REF 1 MicroRNA-29a regulates intestinal membrane permeability in patients with irritable bowel syndrome. Gut. 2010 Jun;59(6):775-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.