Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35194 Target Info
Target Name Dual specificity protein phosphatase 1 (DUSP1)
Synonyms VH1; Protein-tyrosine phosphatase CL100; PTPN10; Mitogen-activated protein kinase phosphatase 1; MKP1; MKP-1; MAP kinase phosphatase-1; MAP kinase phosphatase 1; Dual specificity protein phosphatase hVH1; CL100
Target Type Clinical trial Target
Gene Name DUSP1
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P28562
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Microarray [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a (miR-146a) knockdown prevents and miR-146a transfection induces DUSP1 expression, which lead to increases or decreases in TNFA and IL-6 translation, respectively. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-940 miRNA Info
miRNA Mature AC
MIMAT0004983
Sequence aaggcagggcccccgcucccc
miRNA Species Homo sapiens
Regulation Mechanism miR-940 was increased in RIP1 knockdown cells. Knockdown of miR-940 effectively restored MKP1 expression in RIP1 knockdown cells but had little effect on the MKP1 expression level. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA Dual specificity protein phosphatase 1 (DUSP1) Target Info
DUS1_HUMAN
Programmed cell death 1 ligand 1 (PD-L1) Target Info
PD1L1_HUMAN
References  Top
REF 1 MicroRNA-200c modulates DUSP-1 expression in diabetes-induced cardiac hypertrophy. Mol Cell Biochem. 2017 Jan;424(1-2):1-11.
REF 2 Dysregulation of miR-106a and miR-591 confers paclitaxel resistance to ovarian cancer. Br J Cancer. 2013 Jul 23;109(2):452-61.
REF 3 Mitogen-activated protein kinase phosphatase 1 disrupts proinflammatory protein synthesis in endotoxin-adapted monocytes. Clin Vaccine Immunol. 2013 Sep;20(9):1396-404.
REF 4 Retaining MKP1 expression and attenuating JNK-mediated apoptosis by RIP1 for cisplatin resistance through miR-940 inhibition. Oncotarget. 2014 Mar 15;5(5):1304-14.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.