Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T33425 Target Info
Target Name Epidermal growth factor (EGF)
Synonyms Proepidermal growth factor; Pro-epidermal growth factor
Target Type Successful Target
Gene Name EGF
Biochemical Class Growth factor
UniProt ID
P01133
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-5p miRNA Info
miRNA Mature AC
MIMAT0004570
Sequence cguguauuugacaagcugaguu
miRNA Species Homo sapiens
Regulation Mechanism EGF is a bona fide miR-223 target and its reduced expression and secretion in miR-223 overexpressing cells is able to reduce EGFR signaling pathway activation. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Epidermal growth factor (EGF) Target Info
EGF_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
References  Top
REF 1 Radiotherapy-induced miR-223 prevents relapse of breast cancer by targeting the EGF pathway. Oncogene. 2016 Sep 15;35(37):4914-26.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.