Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T27736 Target Info
Target Name Programmed cell death protein 2 (PD-2)
Synonyms Zinc finger protein Rp8; Zinc finger protein Rp-8; Zinc finger MYND domaincontaining protein 7; Zinc finger MYND domain-containing protein 7; ZMYND7; RP8
Target Type Clinical trial Target
Gene Name PDCD2
UniProt ID
Q16342
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-129-1-3p miRNA Info
miRNA Mature AC
MIMAT0004548
Sequence aagcccuuaccccaaaaaguau
miRNA Species Homo sapiens
Regulation Mechanism miR-129-1-3p might promote proliferation of BGC823 cells by targeting PDCD2. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
References  Top
REF 1 miR-129-1-3p promote BGC-823 cell proliferation by targeting PDCD2. Anat Rec (Hoboken). 2014 Dec;297(12):2273-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.