Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T27600 Target Info
Target Name Transforming acidic coiled-coil protein 3 (TACC3)
Synonyms Transforming acidic coiled-coil-containing protein 3; ERIC1; ERIC-1
Target Type Literature-reported Target
Gene Name TACC3
UniProt ID
Q9Y6A5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism miR-152 binds specifically to the 3'UTR region of TACC3, blocking its transcription. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-425-5p miRNA Info
miRNA Mature AC
MIMAT0003393
Sequence aaugacacgaucacucccguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-425 binds specifically to the 3'UTR region of TACC3, blocking its transcription. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.