Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T23673 Target Info
Target Name Proto-oncogene c-RAF (c-RAF)
Synonyms cRaf; Raf-1; RAF proto-oncogene serine/threonine-protein kinase; RAF
Target Type Clinical trial Target
Gene Name RAF1
Biochemical Class Kinase
UniProt ID
P04049
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunofluorescence; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism Co-transfection with miR-7 suppressed luciferase activity of the RAF1 reporters confirming the seed binding sequences of miR-7 on the 3'UTR region of RAF1. [4]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
MIMAT0000252
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the changed mRNA level of target RAF1. [5]
Evidence Score (E-score) 1 +
1 qRT-PCR; Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
ACK1_HUMAN
Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
miRNA Mature ID hsa-miR-7-1-3p miRNA Info
miRNA Mature AC
MIMAT0004553
Sequence caacaaaucacagucugccaua
miRNA Species Homo sapiens
Regulation Mechanism Introduction of miR-7 mimics decreased the expressions of CRAF and further suppressed the activation of MAPK and PI3K/AKT pathway. [6]
Evidence Score (E-score) 1 +
1 Western Blot [6]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
Insulin-like growth factor I receptor (IGF1R) Target Info
IGF1R_HUMAN
References  Top
REF 1 Upregulation of miR-195 increases the sensitivity of breast cancer cells to Adriamycin treatment through inhibition of Raf-1. Oncol Rep. 2013 Aug;30(2):877-89.
REF 2 Analysis of MiR-195 and MiR-497 expression, regulation and role in breast cancer. Clin Cancer Res. 2011 Apr 1;17(7):1722-30.
REF 3 MicroRNA-125a-5p Is a Downstream Effector of Sorafenib in Its Antiproliferative Activity Toward Human Hepatocellular Carcinoma Cells. J Cell Physiol. 2017 Jul;232(7):1907-1913.
REF 4 MicroRNA-7 as a tumor suppressor and novel therapeutic for adrenocortical carcinoma. Oncotarget. 2015 Nov 3;6(34):36675-88.
REF 5 Prevalence of anthelmintic resistance on sheep and goat farms in the southeastern United States. J Am Vet Med Assoc. 2008 Dec 15;233(12):1913-9.
REF 6 miR-7 reverses the resistance to BRAFi in melanoma by targeting EGFR/IGF-1R/CRAF and inhibiting the MAPK and PI3K/AKT signaling pathways. Oncotarget. 2016 Aug 16;7(33):53558-53570.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.