Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T22977 Target Info
Target Name Superoxide dismutase Cu-Zn (SOD Cu-Zn)
Synonyms hSod1; Superoxide dismutase [Cu-Zn]; Superoxide dismutase 1; Superoxide dismutase
Target Type Clinical trial Target
Gene Name SOD1
Biochemical Class Superoxide dismutase/reductase
UniProt ID
P00441
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-377-3p miRNA Info
miRNA Mature AC
MIMAT0000730
Sequence aucacacaaaggcaacuuuugu
miRNA Species Homo sapiens
Regulation Mechanism In a luciferase assay in which the 3 -UTRs of SOD1 were included in the pGL3R vector, miR-377 considerably reduced luciferase activity. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism SOD1 was a direct target for miR-206. [3]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 miR-17* suppresses tumorigenicity of prostate cancer by inhibiting mitochondrial antioxidant enzymes. PLoS One. 2010 Dec 22;5(12):e14356.
REF 2 MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J. 2008 Dec;22(12):4126-35.
REF 3 MicroRNA profiling of atrial fibrillation in canines: miR-206 modulates intrinsic cardiac autonomic nerve remodeling by regulating SOD1. PLoS One. 2015 Mar 27;10(3):e0122674.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.