Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T22104 |
Target Info
|
| Target Name |
Gremlin-1 (Gremlin-1) |
| Synonyms |
Proliferation-inducing gene 2; PIG2; Increased in high glucose protein 2; IHG-2; Down-regulated in Mos-transformed cells protein; DRM; DAND2; DAN domain family member 2; Cysteine knot superfamily 1, BMP antagonist 1; Cell proliferation-inducing gene 2 protein; CKTSF1B1 |
| Target Type |
Patented-recorded Target |
| Gene Name |
GREM1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-27a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agggcuuagcugcuugugagca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
GREM1 was a direct target of miRNA-27a. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Epidermal growth factor receptor (EGFR)
|
Target Info
|
|
|
Gremlin-1 (Gremlin-1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-27a attenuates adipogenesis and promotes osteogenesis in steroid-induced rat BMSCs by targeting PPAR and GREM1. Sci Rep. 2016 Dec 2;6:38491.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
