Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T19760 Target Info
Target Name Mixed lineage kinase 1 (MAP3K9)
Synonyms PRKE1; Mitogen-activated protein kinase kinase kinase 9; MLK1
Target Type Clinical trial Target
Gene Name MAP3K9
Biochemical Class Kinase
UniProt ID
P80192
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a overexpression results in the downregulation of MAP3K9. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-15a-3p miRNA Info
miRNA Mature AC
MIMAT0004488
Sequence caggccauauugugcugccuca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Mixed lineage kinase 1 (MAP3K9) Target Info
M3K9_HUMAN
miRNA Mature ID hsa-miR-1247-5p miRNA Info
miRNA Mature AC
MIMAT0005899
Sequence acccgucccguucguccccgga
miRNA Species Homo sapiens
Regulation Mechanism miR-1247 suppressed the transcription activity of the MAP3K9 gene by targeting the 3'UTR. mRNA and protein levels of MAP3K9 were also down-regulated when the MG63 cells with miR-1247 overexpression. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA Mixed lineage kinase 1 (MAP3K9) Target Info
M3K9_HUMAN
References  Top
REF 1 Role of miR-148a in cutaneous squamous cell carcinoma by repression of MAPK pathway. Arch Biochem Biophys. 2015 Oct 1;583:47-54.
REF 2 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 3 MicroRNA-148b enhances proliferation and apoptosis in human renal cancer cells via directly targeting MAP3K9. Mol Med Rep. 2016 Jan;13(1):83-90.
REF 4 MicroRNA-34a is a potent tumor suppressor molecule in vivo in neuroblastoma. BMC Cancer. 2011 Jan 25;11:33.
REF 5 Role of miR-15a in intervertebral disc degeneration through targeting MAP3K9. Biomed Pharmacother. 2017 Mar;87:568-574.
REF 6 MiRNA profile of osteosarcoma with CD117 and stro-1 expression: miR-1247 functions as an onco-miRNA by targeting MAP3K9. Int J Clin Exp Pathol. 2015 Feb 1;8(2):1451-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.