Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T19334 Target Info
Target Name Interleukin 21 receptor (IL21R)
Synonyms UNQ3121/PRO10273; Novel interleukin receptor; NILR; Interleukin-21 receptor; IL21 receptor; IL-21R; IL-21 receptor; CD360
Target Type Clinical trial Target
Gene Name IL21R
Biochemical Class Cytokine receptor
UniProt ID
Q9HBE5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 2 MiR-30a inhibits Th17 differentiation and demyelination of EAE mice by targeting the IL-21R. Brain Behav Immun. 2016 Oct;57:193-199.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.