Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T18477 Target Info
Target Name Heat shock protein 90 alpha (HSP90A)
Synonyms Renal carcinoma antigen NY-REN-38; Lipopolysaccharide-associated protein 2; LPS-associated protein 2; LAP-2; Heat shock protein HSP 90-alpha; Heat shock 86 kDa; HSPCA; HSPC1; HSP90A; HSP86; HSP 86
Target Type Successful Target
Gene Name HSP90AA1
Biochemical Class Heat shock protein
UniProt ID
P07900
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase activity was inhibited by the hsa-miR-148b mimic with the wild type vector, the inhibitory effect of the hsa-miR-148b mimic was not observed in the mutant vector. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-1323 miRNA Info
miRNA Mature AC
MIMAT0005795
Sequence ucaaaacugaggggcauuuucu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Heat shock protein 90 alpha (HSP90A) Target Info
HS90A_HUMAN
miRNA Mature ID hsa-miR-371a-5p miRNA Info
miRNA Mature AC
MIMAT0004687
Sequence acucaaacugugggggcacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Heat shock protein 90 alpha (HSP90A) Target Info
HS90A_HUMAN
References  Top
REF 1 Down-regulation of hsa-miR-148b inhibits vascular smooth muscle cells proliferation and migration by directly targeting HSP90 in atherosclerosis. Am J Transl Res. 2017 Feb 15;9(2):629-637.
REF 2 Up-regulation of miR-21 and miR-23a Contributes to As2 O3 -induced hERG Channel Deficiency. Basic Clin Pharmacol Toxicol. 2015 Jun;116(6):516-23.
REF 3 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.