Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T17758 Target Info
Target Name Urokinase-type plasminogen activator (PLAU)
Synonyms UPA; U-plasminogen activator
Target Type Successful Target
Gene Name PLAU
Biochemical Class Peptidase
UniProt ID
P00749
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-193b-3p resulted in the changed protein level of target PLAU. [2]
Evidence Score (E-score) 3 +
1 Microarray; qRT-PCR; Western Blot [1]
2 Microarray; qRT-PCR; Western Blot [2]
3 Western Blot; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuacc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-23b-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target PLAU. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
2 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism PLAU expression was directly regulated by miR-193a-3p. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
References  Top
REF 1 TGF-1 alters microRNA profile in human gastric cancer cells. Chin J Cancer Res. 2013 Feb;25(1):102-11.
REF 2 MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells. FEBS J. 2009 Jun;276(11):2966-82.
REF 3 Downregulation of miR-193b contributes to enhance urokinase-type plasminogen activator (uPA) expression and tumor progression and invasion in human breast cancer. Oncogene. 2009 Nov 5;28(44):3937-48.
REF 4 Human papillomavirus type 16 E6 induces cervical cancer cell migration through the p53/microRNA-23b/urokinase-type plasminogen activator pathway. Oncogene. 2011 May 26;30(21):2401-10.
REF 5 Arm Selection Preference of MicroRNA-193a Varies in Breast Cancer. Sci Rep. 2016 Jun 16;6:28176.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.