Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16792 Target Info
Target Name Iodothyronine deiodinase type I (DIO1)
Synonyms Type-I 5'-deiodinase; Type I iodothyronine deiodinase; Type 1 DI; TXDI1; ITDI1; DIOI; 5DI
Target Type Successful Target
Gene Name DIO1
UniProt ID
P49895
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-224-5p miRNA Info
miRNA Mature AC
MIMAT0000281
Sequence ucaagucacuagugguuccguuuag
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of DIO1 is a direct target for miR-224. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA APJ endogenous ligand (Apelin) Target Info
APEL_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-383-5p miRNA Info
miRNA Mature AC
MIMAT0000738
Sequence agaucagaaggugauuguggcu
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of DIO1 is a direct target for miR-383. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 Regulatory feedback loop between T3 and microRNAs in renal cancer. Mol Cell Endocrinol. 2014 Mar 25;384(1-2):61-70.
REF 2 MiR-224 targets the 3'UTR of type 1 5'-iodothyronine deiodinase possibly contributing to tissue hypothyroidism in renal cancer. PLoS One. 2011;6(9):e24541.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.