Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16738 Target Info
Target Name Protein delta homolog 1 (DLK1)
Synonyms pG2; DLK-1
Target Type Clinical trial Target
Gene Name DLK1
UniProt ID
P80370
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 MicroRNA-15a fine-tunes the level of Delta-like 1 homolog (DLK1) in proliferating 3T3-L1 preadipocytes. Exp Cell Res. 2010 Jun 10;316(10):1681-91.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.