Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16596 Target Info
Target Name PIM-3 protein kinase (PIM3)
Synonyms Serine/threonine-protein kinase pim-3
Target Type Patented-recorded Target
Gene Name PIM3
Biochemical Class Kinase
UniProt ID
Q86V86
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism Transfection of both cell lines with the miR-33a mimics repressed the luciferase activity of the wild-type Pim-3 3'UTR construct. [2]
Evidence Score (E-score) 2 +
1 Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Sequencing [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-506-3p miRNA Info
miRNA Mature AC
MIMAT0002878
Sequence uaaggcacccuucugaguaga
miRNA Species Homo sapiens
Regulation Mechanism miR-506 represses luciferase activity by significantly targeting the PIM3 3'UTR. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 MicroRNA-33a-mediated downregulation of Pim-3 kinase expression renders human pancreatic cancer cells sensitivity to gemcitabine. Oncotarget. 2015 Jun 10;6(16):14440-55.
REF 2 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 3 MicroRNA 06 participates in pancreatic cancer pathogenesis by targeting PIM3. Mol Med Rep. 2015 Oct;12(4):5121-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.