Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T16347 Target Info
Target Name Protein-tyrosine phosphatase 1B (PTP1B)
Synonyms Tyrosine-protein phosphatase non-receptor type 1; PTP-1B
Target Type Clinical trial Target
Gene Name PTPN1
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P18031
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Regulation Mechanism PTPN1 was down-modulated following miR-210 overexpression and induced when miR-210 was inhibited. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay? [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Regulation Mechanism PTP1B as a Direct Target of MiR-122. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-362-3p miRNA Info
miRNA Mature AC
MIMAT0004683
Sequence aacacaccuauucaaggauuca
miRNA Species Homo sapiens
Regulation Mechanism PTPN1 are direct miR-362-3p targets. [4]
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Protein-tyrosine phosphatase 1B (PTP1B) Target Info
PTN1_HUMAN
References  Top
REF 1 An integrated approach for experimental target identification of hypoxia-induced miR-210. J Biol Chem. 2009 Dec 11;284(50):35134-43.
REF 2 Hypoxia-inducible miR-210 regulates the susceptibility of tumor cells to lysis by cytotoxic T cells. Cancer Res. 2012 Sep 15;72(18):4629-41.
REF 3 Decrease of microRNA-122 causes hepatic insulin resistance by inducing protein tyrosine phosphatase 1B, which is reversed by licorice flavonoid. Hepatology. 2012 Dec;56(6):2209-20.
REF 4 MiRNA-362-3p induces cell cycle arrest through targeting of E2F1, USF2 and PTPN1 and is associated with recurrence of colorectal cancer. Int J Cancer. 2013 Jul;133(1):67-78.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.